Tam Kinase Receptor Inhibition-A Possible Therapeutic Intervention to Prevent Breast Cancer Recurrence After Therapy

This article has 0 evaluations Published on
Read the full article Related papers
This article on Sciety

Abstract

Breast Cancer appears in various forms afflicting an increasing number of women around the globe. Therapeutic resistance in Breast Cancer has been associated with overexpression of Tyro3 Kinase Receptor. Inhibition of Tyro3 with LDC1267 is reported to control metastasis in breast cancer. The aim of the study was to investigate the apoptotic effect of Tyro3 inhibition relative to WNT signaling responsible for transforming MCF-7 and MDA-MB-231 cells. Soft agar colony formation assay and focus formation assay were carried out with 2× (0.81uM, 1.62uM, 3.24uM and 6.48uM) concentrations added to 1% bacto-agar 50% v/v in the bottom layer and 5000 cells with media containing 0.5% agar (50% v/v) in the top layer in triplicates in six well plates incubated on 37oC and in 5% CO2 for 15 days for forming colonies in soft agar. For Focus formation assay 40,000 cells /well were plated in 24 well plates in triplicates and incubated (for around 72 hours) until they reach confluence then inhibitor was added and plates were incubated at 37oC and 5% CO2 for 15 days after which crystal violet staining was undertaken. The expression analysis of WNT signaling mediators c-Myc and Axin-2 was carried out via RT-PCR using the following primer sequences (5’-3’) c-Myc (F) ‘GAAAAGGCCCCCAAGGTAGT’, c-Myc (R) ‘AGTTTGTGTTTCAACTGTTC’, Axin-2 (F) ‘CTATGTCTTTGCACCAGCCA’, Axin-2 (R) ‘TAGAGACACTTGGCCATTGG’, GAPDH (F) ‘CATCACCATCTTCCAGGAG’ and GAPDH (R)’ GATGATGACCCTTTTGGC’. Decreased foci and colony number indicated anti-transformation effects of Tyro3 inhibition. Western Blot analysis with cleaved caspase 3, Bax and BCl2 antibodies confirmed cell death by intrinsic apoptotic pathway. Elevated c-Myc and Axin-2 in MCF-7 and decreased expression of both in MDA-MB-231 indicated WNT pathway involvement, preferably feedback loop occurring in MCF-7 and aberrant gene suppression in MDA-MB-231 thereby halting its aggressiveness. This study proves that Tyro3 inhibition has significant inhibitory effects on transforming cells via WNT pathway.

Related articles

Related articles are currently not available for this article.